View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_50 (Length: 279)
Name: NF4285_low_50
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 4 - 274
Target Start/End: Original strand, 45704161 - 45704429
Alignment:
| Q |
4 |
tttttcaacatagttcacattgtatataataggaacttgcagactgataccttcaaccttacaagttttattatttctcatgcgaaaaatttcacattat |
103 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45704161 |
tttttcaacatagttcacattgtata--ataggaacttgtagactgataccttcaaccttacaagttttattatttctcatgcgaaaaatttcacattat |
45704258 |
T |
 |
| Q |
104 |
ttcaactctaaagtctcgagttatttattccttcgatacatgtgataagagcatctattctccatgacccaacttacttcagttttcgaactagttacca |
203 |
Q |
| |
|
|||| |||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45704259 |
ttcagctctaaagtctccggttattcattccttggatacatgtgataagagcatctattctccatgacccaacttacttcagttttcgaactagttacca |
45704358 |
T |
 |
| Q |
204 |
ctaatgcactcgcattttcataacccttatactttgactctttgctccctactaaattttttgtctctgtg |
274 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45704359 |
ctaatgcactcgcattctcataaccattatactttgactctttgctccctactaaattttttgtctttgtg |
45704429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University