View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_51 (Length: 272)
Name: NF4285_low_51
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 45729384 - 45729121
Alignment:
| Q |
1 |
tgtcgatggtggaggatgggggtggagacggtggcgtttgatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcg |
100 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729384 |
tgtcaatggtggaggatggtggtggagacggtggcgtttgatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcg |
45729285 |
T |
|
| Q |
101 |
gagagccagacacgttggccgccgtggatgaaatagagacgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729284 |
gagagccagacacgttggccgccgtggatgaaatagagacgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaa |
45729185 |
T |
|
| Q |
201 |
ggaatctcttcannnnnnnctctgcaacttgttttttaccatcttccatgtgtgtgttcatctc |
264 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45729184 |
ggaatctcttcatttttttctctgcaacttgttttttaccatcttccatgtgtgtgttcttctc |
45729121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 35 - 205
Target Start/End: Complemental strand, 45725161 - 45724991
Alignment:
| Q |
35 |
cgtttgatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaat |
134 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725161 |
cgttggatgtatgagattgtgaggggaatgagcatcaaggggaaaccggcagtttccaggcaggcggagagccagacacgttggccgccgtggatgaaat |
45725062 |
T |
|
| Q |
135 |
agagacgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaat |
205 |
Q |
| |
|
||||||||||||| |||||| ||| | || ||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
45725061 |
agagacgcattattaggggaccaccggagttacctagggctaatatcagacaatttactatcagaaggaat |
45724991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University