View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_52 (Length: 268)
Name: NF4285_low_52
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 37025339 - 37025094
Alignment:
| Q |
1 |
gagaagttgagactgaaaagattacctttaagtccaaagtttgcaacatttacaattgtcacagaatttgtttcatcacaaacaattccttcccaattgc |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025339 |
gagaagttgagactgaaaagagtacctttaagtccaaagtttgcaacatttacaattgtcacagaatttgtttcatcacaaacaattccttcccaattgc |
37025240 |
T |
 |
| Q |
101 |
aaggacttgaaaaggttgtccaagaagataatgaagcttggctttgtttgtcaaggttggttttccaatttaatagagcaattgcttcactacctttatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025239 |
aaggacttgaaaaggttgtccaagaagataatgaagcttggctttgtttgtcaaggttggttttccaatttaatagagcaattgcttcactacctttatc |
37025140 |
T |
 |
| Q |
201 |
ttttgtagcattagttgcagcaaaactgaaaatgccataaacttgg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025139 |
ttttgtagcattagttgcagcaaaactgaaaatgccataaacttgg |
37025094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 33042246 - 33042297
Alignment:
| Q |
142 |
ctttgtttgtcaaggttggttttccaatttaatagagcaattgcttcactac |
193 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||| ||||||| |||| |
|
|
| T |
33042246 |
ctttgcttgtcaaggttggatttccaattcaatagagcacttgcttctctac |
33042297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University