View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_55 (Length: 256)
Name: NF4285_low_55
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_55 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 24 - 256
Target Start/End: Complemental strand, 32798001 - 32797769
Alignment:
| Q |
24 |
agtgcaaccacgataaagcttctgattaggatcagacaaaatatgcgcatgacaatacttagtaagagccatagctttggtcttacagccagtataagca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798001 |
agtgcaaccacgataaagcttctgattaggatcagacaaaatatgcgcatgacaatacttagtaagagccatagctttggtcttacagccagtataagca |
32797902 |
T |
 |
| Q |
124 |
caccgaacaaaatcatcaccattatcaaaagcaccagcagcagaagcgttacccgaatcccttacaccgtttgaatttctttcttcatcttctttgaacg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32797901 |
caccgaacaaaatcatcaccattatcaaaagcaccagcagcagaagcgttacccgaatcccttacaccgtttgaatttctttcttcatcttctttgaacg |
32797802 |
T |
 |
| Q |
224 |
gactccttccataagtccagtaatactctctgt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32797801 |
gactccttccataagtccagtaatactctctgt |
32797769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University