View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_56 (Length: 253)
Name: NF4285_low_56
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_56 |
 | |
|
| [»] scaffold0318 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0318 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 3 - 237
Target Start/End: Original strand, 5424 - 5658
Alignment:
| Q |
3 |
ctttcaatacaaaggtaaaaacatcgtcgtctagagtattgtggtgtatatctaatatcttcattcttcaattttgctcattaatctttgatactttggg |
102 |
Q |
| |
|
|||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
5424 |
ctttcaatacaaaggtaagaacatcgtc---taaagtattgtggtgtatatctaatatcttcattcttcaattttgctcattaatctttgttagtttggg |
5520 |
T |
|
| Q |
103 |
accattttattaaag---tgtgagatgttcatgtccactcaaagtggaacagaggtgaactccttaaattctgatgaatgagtggccataattaacctat |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5521 |
accattttattaaagaagtgtgagatgttcatgtccactcaaagtggaacagaggtgaactccttaaattctgatgaatgagtggccataattaacctat |
5620 |
T |
|
| Q |
200 |
tacatatgcttccttggtttctcatcatggccagaatg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5621 |
tacatatgcttccttggtttctcatcatggccagaatg |
5658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University