View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_70 (Length: 239)
Name: NF4285_low_70
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_70 |
 |  |
|
| [»] scaffold0318 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0318 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 5106 - 4878
Alignment:
| Q |
1 |
cccaaattttagtaatgaatagtaaaaataaatgtagatgatgtacattgtccttcaactcccaacctgtctatatgtgcactcttattcgacatctttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106 |
cccaaattttagtaatgaatagtaaaaattaatgtagatgatgtacattgtccttcaactcccaacctgtctatatgtgcactcttattcgacatctttt |
5007 |
T |
 |
| Q |
101 |
gtccccaaccgatataaaccaatgagcacgtgtgtcatgatcattgcacttcgtggtagaccaaattattcaatctcacaactacgtgcatgaaccaaac |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5006 |
gtccccaaccgatataaaccaataagcacgtgtgtcatgatcattgcacttcgtggtagaccaaattattcaatctcacaactacgtgcatgaaccaaac |
4907 |
T |
 |
| Q |
201 |
ttagttatctgcttagccatgtgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4906 |
ttagttatctgcttagccatgtgatgatg |
4878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University