View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_76 (Length: 229)
Name: NF4285_low_76
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_76 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 39669186 - 39668964
Alignment:
| Q |
7 |
gttttagggttgagaaacaaatcgcaaacaccttagttaattatgaataaatacctaagttgggacatcattaaggtgtaaggaaaggattcaagcttcn |
106 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39669186 |
gtttttgggttgagaaacaaatcgtaaacaccttagttaattatgaataaatacctaagttgggacatcattaaggtgttaggaaaggattcaagcttct |
39669087 |
T |
 |
| Q |
107 |
nnnnnnctttcttctagtgtgtccttgagtgaacatcattcattggttggaaaatgacatgagaaaaattagggatggctcttagtgagtaatggaggat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | | |||||||| |
|
|
| T |
39669086 |
ttttttctttcttctagtgtgtccttgagtgaacatcattcattggttagaaaatgacatgagaaaaattagggatggctcttagtgcgcagtggaggat |
39668987 |
T |
 |
| Q |
207 |
aatttcttgatgatcatttttgt |
229 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
39668986 |
aatttcttgatgatcacttttgt |
39668964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University