View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4285_low_76 (Length: 229)

Name: NF4285_low_76
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4285_low_76
NF4285_low_76
[»] chr4 (1 HSPs)
chr4 (7-229)||(39668964-39669186)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 39669186 - 39668964
Alignment:
7 gttttagggttgagaaacaaatcgcaaacaccttagttaattatgaataaatacctaagttgggacatcattaaggtgtaaggaaaggattcaagcttcn 106  Q
    ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||     
39669186 gtttttgggttgagaaacaaatcgtaaacaccttagttaattatgaataaatacctaagttgggacatcattaaggtgttaggaaaggattcaagcttct 39669087  T
107 nnnnnnctttcttctagtgtgtccttgagtgaacatcattcattggttggaaaatgacatgagaaaaattagggatggctcttagtgagtaatggaggat 206  Q
          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | | ||||||||    
39669086 ttttttctttcttctagtgtgtccttgagtgaacatcattcattggttagaaaatgacatgagaaaaattagggatggctcttagtgcgcagtggaggat 39668987  T
207 aatttcttgatgatcatttttgt 229  Q
    |||||||||||||||| ||||||    
39668986 aatttcttgatgatcacttttgt 39668964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University