View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_80 (Length: 220)
Name: NF4285_low_80
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_80 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 198
Target Start/End: Original strand, 30128252 - 30128439
Alignment:
| Q |
11 |
gagtgagaagaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30128252 |
gagtgaaaagaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa |
30128351 |
T |
 |
| Q |
111 |
atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttcttagtcattcgatcgagcaagattgtctgaggccttgtt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30128352 |
atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttcttagtcattcgaccgagcaagattgtctgaggccttgtt |
30128439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University