View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_81 (Length: 220)
Name: NF4285_low_81
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 19 - 184
Target Start/End: Complemental strand, 30855483 - 30855319
Alignment:
| Q |
19 |
catggaggaatgagtttttatcatctctatggttttaaattggatattcttgagaatcaatgtttggatttatccatcaaccatgataaaaaatttcaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||| |
|
|
| T |
30855483 |
catggaggaatgagtttttatcatctctatggttttaacttggatattcttgagaatcaatgtttggatttatccatcaaccatgatcagaattttcaaa |
30855384 |
T |
|
| Q |
119 |
gctacatattatccaacatgagannnnnnnnggtgccaaattaggccataatctaagttttatatg |
184 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30855383 |
gctacatattatccaacatgaga-attttttggtgccaaattaggccataatctaagttttatatg |
30855319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University