View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_82 (Length: 215)
Name: NF4285_low_82
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_82 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 39536131 - 39536322
Alignment:
| Q |
13 |
atgaaattaattttatctatttggtggttcattcctacaattgctagtt-----gacagaatgacaaaaatgaatgatgttttttatttggagtattttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39536131 |
atgaaattaattttatctatttggtggttcattcctacaattgctagttgagttgacagaatgacaaaaatgaatgatgttttttatttggagtattttt |
39536230 |
T |
|
| Q |
108 |
tgattgataattggcctttcatgggagagtaacataacttagatttatacttgaatattgagaaagctacatgtttaagagatggaagggtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39536231 |
tgattgataattggcctttcatgggagagtaaaataacttagatttatacttgaatattgagaaagctacatgtttaagagatgtaagggtt |
39536322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University