View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4286_high_7 (Length: 264)
Name: NF4286_high_7
Description: NF4286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4286_high_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 35501137 - 35500890
Alignment:
| Q |
18 |
atcattacttgttatactatgagaaaatttgttttgagagnnnnnnnta-tatttcacactgtgttctgtataacacgtaaacatcacaagaacatggta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35501137 |
atcattacttgttatactatgagaaaatttgttttgagagaaaaaaaaaatatttcacactgtgttctgtataacacgtaaacatcacaagaacatggta |
35501038 |
T |
 |
| Q |
117 |
tgctgatattttcagcaaggggtagcactctactaagatattcagttgataccattcatcttatacttaagattgtggtttttcttggggttggggtaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35501037 |
tgctgatattttcagcaaggggtagcactctactaagatattcagttgataccattcatcttatacttaagattgtggtttttcttggggttggggtaga |
35500938 |
T |
 |
| Q |
217 |
ggtggggtttgcttggcttctcaaaaaggaccttcctctcattcttgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35500937 |
ggtggggtttgcttggcttctcaaaaaggaccttcctctcattcttgt |
35500890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University