View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4286_low_10 (Length: 292)
Name: NF4286_low_10
Description: NF4286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4286_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 47458594 - 47458871
Alignment:
| Q |
1 |
tggatgcccttgaatctcagaaagttgttgatcttctcaattctcagttgtctcgtttgctcaagttgaaacccaaagatttttggtcacaaggtacatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47458594 |
tggatgcccttgaatctcagaaagttgttgatcttctcaattctcagttgtcttgtttgctcaagttgaaacccaaagatttttggtcacaaggtacatc |
47458693 |
T |
|
| Q |
101 |
attttaatcagtttaattgaagttaaacatttttagtgatgtgatctgacaatttacaattatgattgattgaatgtgtattatgaattaacttctattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47458694 |
attttaatcagtttaattgaagttaaacatttttagtgatgtgatctgacaatttacaattatgattgattgaatgtgtaatatgaattaacttctattg |
47458793 |
T |
|
| Q |
201 |
taatattatctaactaatatttgttaaaattcatcatccatgcatggcttgtgctattacgttggaattgtttgttca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
47458794 |
taatattatctaactaatatttgttaaaattcatcatccatgcatggcgtgtgctattacgttggaaatgtttgttca |
47458871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University