View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4286_low_14 (Length: 237)
Name: NF4286_low_14
Description: NF4286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4286_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 33216652 - 33216469
Alignment:
| Q |
13 |
cttcaagaagatcattatctctctctggtgattcagaaccaggtaaaccaagtcttaactcagtagccttgaggttcaagccattgttacttctttgaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33216652 |
cttcaagaagatcattatctctctctggtgattcagaaccaggtaaaccaagtcttaactcagtagccttgaggttcaagccattgttacttctttgaga |
33216553 |
T |
 |
| Q |
113 |
aaatatctcagaactttccattgtagtagtggaaactttaacttcagtttgcaaaacaactttagtataaagaaaaataatgat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
33216552 |
aaatatctcagaactttccattgtagtagtggaaactttaacttcagtttgcaaaactactttagtataaagaaaaacaatgat |
33216469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University