View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4286_low_16 (Length: 229)

Name: NF4286_low_16
Description: NF4286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4286_low_16
NF4286_low_16
[»] chr2 (1 HSPs)
chr2 (1-133)||(4801850-4801982)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 4801982 - 4801850
Alignment:
1 aatttgaaaaaggaatgtttgtgtttttgcactttttgcgtgattgatgtgctgatgtatcgaaattactaaattttataaggaaattttcttgttttat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||    
4801982 aatttgaaaaaggaatgtttgtgtttttgcactttttgcgtgattgatgtgctaatgtatcgaaattactaaattttaaaaggaaattttcttgttttat 4801883  T
101 tacggtgcttttgatttcgattattctgcaaaa 133  Q
    |||||||| ||||||||||||||||||||||||    
4801882 tacggtgcctttgatttcgattattctgcaaaa 4801850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University