View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4287-Insertion-11 (Length: 132)
Name: NF4287-Insertion-11
Description: NF4287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4287-Insertion-11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 9049688 - 9049818
Alignment:
| Q |
1 |
cagcaagagctactgctcaagctgctgtggaagttgcaaggttgactaagagttcaaatcatgcgtagggagcattatgctgctgttgtgattcaaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9049688 |
cagcaagagctactgctcaagctgctgtggaagttgcaaggttgactaagagttcaaatcatgc-tagggagcattatgcagctgttgtgattcaaactt |
9049786 |
T |
|
| Q |
101 |
cttttagaggttatttggtgagttcccataac |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
9049787 |
cttttagaggttatttggtgagttcacataac |
9049818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University