View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4287-Insertion-7 (Length: 61)
Name: NF4287-Insertion-7
Description: NF4287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4287-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 40926450 - 40926390
Alignment:
| Q |
1 |
agattcccaccaaaacaccaaattaactgtttctatagataaataaagattttcttttata |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40926450 |
agattcccaccaaaacaccaaattaactgtttctatagataaatgaagattttcttttata |
40926390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University