View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4287-Insertion-9 (Length: 123)
Name: NF4287-Insertion-9
Description: NF4287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4287-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 6 - 123
Target Start/End: Original strand, 30967128 - 30967245
Alignment:
| Q |
6 |
ctgagaaagtggtatctaacatctatatgtttacacttcccatgcaatacaggatttttgggcagtttaatagctgaactattatcacactgaatgacag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30967128 |
ctgagaaagtggtatctaacatctatatgtttacacttcccatgcaatacaggatttttgggcagtttaatagatgaactattatcacactgaatgacag |
30967227 |
T |
 |
| Q |
106 |
tgcaatttgttccaggat |
123 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30967228 |
tgcaatttgttccaggat |
30967245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 6 - 94
Target Start/End: Original strand, 9938663 - 9938751
Alignment:
| Q |
6 |
ctgagaaagtggtatctaacatctatatgtttacacttcccatgcaatacaggatttttgggcagtttaatagctgaactattatcaca |
94 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||||||| || || ||||| | |||||| |||| |||||||||||||| |
|
|
| T |
9938663 |
ctgagaaagtggtatctcacatctatatgtttgcatctcccatgcatcactgggtttttagacagtttgatagaggaactattatcaca |
9938751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University