View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4287_high_10 (Length: 239)
Name: NF4287_high_10
Description: NF4287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4287_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 32232681 - 32232892
Alignment:
| Q |
1 |
tcataatgcaaattaaggagtgaaaatggcacattttcgggcgtcagaactgcaaccctcaagtgtttgtttcctttaactgggtgctaagtaactaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||| |||||| || |
|
|
| T |
32232681 |
tcataatgcaaattaaggagtgaaaatggcacattttcgggcgtcagaactgcaatcctaaagtgcttgtttcctttaactgggtgctaattaactaggc |
32232780 |
T |
 |
| Q |
101 |
gccccagcatccgcacaacaccccgtattgaacttgttgctctataaatacatttttagcagattaaaggcatcttttgatcactttttacttgagaaac |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
32232781 |
gccccagcatccgcacagcaccccgtattggacttgttgctctataaatacatttttagcagattaaaggtatcttttgatcacttttcacttgagaaac |
32232880 |
T |
 |
| Q |
201 |
ttgttccctagc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32232881 |
ttgttccctagc |
32232892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University