View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4287_low_14 (Length: 253)
Name: NF4287_low_14
Description: NF4287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4287_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 243
Target Start/End: Complemental strand, 28256141 - 28255913
Alignment:
| Q |
15 |
gtataatgtatagtaactcacttcacttgtgtcaagaagtgaatgatcaattatgattcacatatttgtgattttgtaggaaggagcaagagaaggtagc |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28256141 |
gtataatgtatagttactcacttcacttgtgtcaagaagtgaatgatcaattgtgattcacatatttgtgattttgtaggaaggagcaagagaaggtagc |
28256042 |
T |
|
| Q |
115 |
aatgtaatggaactctatccaaccggttccaccataccagattgttcccatgcatgtggaccatgttcaccctgcaaaagggtcatggtaggttacaaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
28256041 |
aatgtaatggaactctatccaaccggttccaccataccagattgttcccatgcatgtggaccatgttcaccctgcaagagagtcatggtaggttacaaca |
28255942 |
T |
|
| Q |
215 |
aatgttctatggcagagtcttgtcctatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28255941 |
aatgttctatggcagagtcttgtcctatg |
28255913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University