View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4288_high_10 (Length: 246)
Name: NF4288_high_10
Description: NF4288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4288_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 82 - 229
Target Start/End: Complemental strand, 38316617 - 38316465
Alignment:
| Q |
82 |
taattaccaaacaattttaactttaccttaaagcacttattgttagttttggcttccaaataacctataaatcctnnnnnnngcttggccaaaca----- |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||| ||||||||||| | ||||||||||| |
|
|
| T |
38316617 |
taattaccaaacaattttaactgtaccttaaagcacttattgttagctttggctttcaaatagtctataaatcctaaaaaaagtttggccaaacatagct |
38316518 |
T |
|
| Q |
177 |
atagtctttcattttaaaagacaaactaactaactatccggtgaatctgtttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38316517 |
atagtctttcattttaaaagacaaactaactaactatccggtgaatcagtttc |
38316465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 141
Target Start/End: Complemental strand, 10490469 - 10490409
Alignment:
| Q |
83 |
aattaccaaacaa-ttttaactttacct-taaagcacttattgttagttttggcttccaaa |
141 |
Q |
| |
|
||||||||||||| ||||| |||| | | |||||||||||||||||| ||||||||||||| |
|
|
| T |
10490469 |
aattaccaaacaacttttagctttgcttctaaagcacttattgttagctttggcttccaaa |
10490409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University