View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4288_high_4 (Length: 398)
Name: NF4288_high_4
Description: NF4288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4288_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 18 - 392
Target Start/End: Original strand, 6485637 - 6486011
Alignment:
| Q |
18 |
gtcaattgctaaagcagttactgcacattcttgttttaaaagttgtttaaccattacatgttttgttgctttaccacgtggttctcttcgccacacttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485637 |
gtcaattgctaaagcagttactgcacattcttgttttaaaagttgtttaaccattacatgttttgttgctttaccacgtggttctcttcgccacacttta |
6485736 |
T |
 |
| Q |
118 |
actgttccgtctgctgaaccagagaaaacaattccgtcgtttccacaaacgacggcgttaactgcatcctcatgggaagtaatggattccaagcactttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485737 |
actgttccgtctgctgaaccagagaaaacaattccgtcgtttccacaaacgacggcgttaactgcatcctcatgggaagtaatggattccaagcactttg |
6485836 |
T |
 |
| Q |
218 |
aatcggcgattctccaaactttgacggttctgtcccatgaagcagagtagaggtgggttttgtctagagaaagtcttaggcatgaaactgcagccgaatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||| ||||||| |
|
|
| T |
6485837 |
aatcggcgattctccaaactttgacggttctgtcccatgaagcagagtagaggtaggttttgtctggagaaagacttaggcatgaaactgcatccgaatg |
6485936 |
T |
 |
| Q |
318 |
tttgagccataatgcagttcggtgttttctaacctcgacataattgcttggtttaatcgagcttttgatgatgtc |
392 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
6485937 |
tttgatccataatgcagttcggtgttttctaacctcgacataattgcttggtttaattgagcttttgaagatgtc |
6486011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University