View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4288_low_8 (Length: 340)
Name: NF4288_low_8
Description: NF4288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4288_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 5481162 - 5481483
Alignment:
| Q |
1 |
attgagaacacgagtaagaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagcaccaccatgcacagcaattgcccaacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5481162 |
attgagaacacgagtaagaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagcaccaccatgcacagcaattgcccaacca |
5481261 |
T |
|
| Q |
101 |
cccatgtttctctctctcacaaactctctgaactttacccttacggtgtttttgttattgatgtttggagtctgcaacaaactatgatacccaaggggcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5481262 |
cccatgtttctctctctcacaaactctctgaactttacccttacggtgtttttgttattgatgtttggagtctgcaacaaactatgatacccaaggggcg |
5481361 |
T |
|
| Q |
201 |
tttttataggcaaattcggacttcaaatgtttatgtgttggatttgaatttatt-ttttattttgaggtctcgtgagtcacaacggtttgtttggtttgg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5481362 |
tttttataggcaaattcggacttcaaatgtttatgtgttggatttgaattttttattttattttgaggtctcgtgagtcacaacggtttgtttggtttgg |
5481461 |
T |
|
| Q |
300 |
gccatagggggtgggtgtccct |
321 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5481462 |
gccatagggggtgggtgtccct |
5481483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 12 - 105
Target Start/End: Original strand, 42165645 - 42165738
Alignment:
| Q |
12 |
gagtaagaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagcaccaccatgcacagcaattgcccaaccacccat |
105 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||||| || ||||| || ||||||||||||||||| ||||||||| |||| |
|
|
| T |
42165645 |
gagtaagaagttgtttggcttcttcctgacgttgtggtgggagattaggatccacaccggcgccaccatgcacagcaatagcccaaccaaccat |
42165738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 118
Target Start/End: Complemental strand, 47170269 - 47170165
Alignment:
| Q |
14 |
gtaagaagttgtttggcttcttcttgacgttgaagagggagattagggtcaacaccagcaccaccatgcacagcaattgcccaaccacccatgtttctct |
113 |
Q |
| |
|
|||||||| ||||||||||||| ||||| || | ||||| ||||| || ||||| ||||| ||||| |||||||| ||||||||| ||||||| | | |
|
|
| T |
47170269 |
gtaagaagctgtttggcttcttgctgacggtgtggtgggaggttaggatccacacctgcaccgccatgaacagcaatagcccaaccagacatgttttttt |
47170170 |
T |
|
| Q |
114 |
ctctc |
118 |
Q |
| |
|
||||| |
|
|
| T |
47170169 |
ctctc |
47170165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University