View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4289_high_10 (Length: 220)
Name: NF4289_high_10
Description: NF4289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4289_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 36465458 - 36465633
Alignment:
| Q |
19 |
tttctaaattcaaaattttagtcctcttgtttcaaaacttttttctcacaatttaatttgaggtttgctttctgtgacgtg-tcctatt-tatt-gatga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||| |||| ||||| |
|
|
| T |
36465458 |
tttctaaattcaaaattttagtcctcttgtttcaaaacttttttctcacaatttaatttgaggtttgctttttgtgacgacatgaaattatattcgatga |
36465557 |
T |
|
| Q |
116 |
catgacattgttgatttgaattagaaacaataaaattctgaaaaataggtttacattcgatgaatgagatcaaaag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465558 |
catgacattgttgatttgaattagaaacaataaaattctgaaaaataggtttacattcgatgaatgagatcaaaag |
36465633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University