View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4289_low_7 (Length: 250)
Name: NF4289_low_7
Description: NF4289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4289_low_7 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 32373564 - 32373325
Alignment:
| Q |
9 |
gagaagaaaaagaagatattagatcttttagccgattcgacaaacttgttagttcaatggcagagaacacaatatacagatccaggtagtaatgtcagtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373564 |
gagaagaaaaagaagatattagatcttttagccgattcgacaaacttgttggttcaatggcagagaacacaatatacagatccaggtagtaatgtcagtg |
32373465 |
T |
 |
| Q |
109 |
tagtaagcaacacaagtagttcatcagctgaagacaattttcgaggtccttctagtgcaaactataacatgaatttgtttgtgaaacttggtgaaatatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
32373464 |
tagtaagcaacacaagtagttcatcagctgaagacaattttcgaggtccttctagtgcaaactataacatgaatttgtttgtg-aacttggtg-aatatt |
32373367 |
T |
 |
| Q |
209 |
tagaagaacaagtttatcaagacaagaagagataagaaacca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32373366 |
tagaagaacaagtttatcaagacaagaagagataagaaacca |
32373325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University