View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4289_low_8 (Length: 248)
Name: NF4289_low_8
Description: NF4289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4289_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 136 - 241
Target Start/End: Original strand, 26583212 - 26583317
Alignment:
| Q |
136 |
cgagatgcggcgaatcgttgaggtaattctctagtgagactatatagaattttgcgtgtgttgtcttcattgtggcgagaagccatctttatgcagggag |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26583212 |
cgagatgcggcgaatcgttgaggtaattctctagtgagactatatagaattttgcgtgtgttgtcttcattgtggcgagaagccatctttatgcagggag |
26583311 |
T |
|
| Q |
236 |
aataat |
241 |
Q |
| |
|
|||||| |
|
|
| T |
26583312 |
aataat |
26583317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University