View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4289_low_9 (Length: 243)

Name: NF4289_low_9
Description: NF4289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4289_low_9
NF4289_low_9
[»] chr6 (1 HSPs)
chr6 (18-233)||(1216703-1216918)


Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 1216918 - 1216703
Alignment:
18 agttggagggtccaggcccactttgacttcaagtactgcaaactgaagaacgtctcaaaagattcaggaaaacttatatacgaagttgggtaacctaatc 117  Q
    |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1216918 agttggagcgtccaggcccactttgacttcaagtactgcaaagtgaagaacgtctcaaaagattcaggaaaacttatatacgaagttgggtaacctaatc 1216819  T
118 ttacagtggcgtggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaattttttgggtttaggaacaacaccc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1216818 ttacagtggcgtggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaattttttgggtttaggaacaacaccc 1216719  T
218 ccactttgaatctctg 233  Q
    ||||||||||||||||    
1216718 ccactttgaatctctg 1216703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University