View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-10 (Length: 105)
Name: NF4290-Insertion-10
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-10 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 43554404 - 43554300
Alignment:
| Q |
1 |
ataataaggtgatggattggaaattctatatagtttatgtaagatatattctaaactgttgactttctatgcagatattgttagagagttgttgaacagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43554404 |
ataataaggtgatggattggaaattctatatagtttatgtaagatatatcctaaactgttgactttctatgcagatattgttagagagttgttgaacagg |
43554305 |
T |
 |
| Q |
101 |
tggcc |
105 |
Q |
| |
|
||||| |
|
|
| T |
43554304 |
tggcc |
43554300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 43550403 - 43550299
Alignment:
| Q |
1 |
ataataaggtgatggattggaaattctatatagtttatgtaagatatattctaaactgttgactttctatgcagatattgttagagagttgttgaacagg |
100 |
Q |
| |
|
|||||||||||||||| || |||| ||||||| | ||||||| ||| | |||||| ||||| | ||||||||||| | ||||||||| ||||||||| | |
|
|
| T |
43550403 |
ataataaggtgatggactgaaaatcttatatagctgatgtaagttatctcctaaacggttgattgtctatgcagatgtcgttagagagctgttgaacaag |
43550304 |
T |
 |
| Q |
101 |
tggcc |
105 |
Q |
| |
|
||||| |
|
|
| T |
43550303 |
tggcc |
43550299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University