View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-15 (Length: 271)
Name: NF4290-Insertion-15
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-15 |
 | |
|
| [»] chr3 (5 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 121 - 271
Target Start/End: Complemental strand, 9112331 - 9112181
Alignment:
| Q |
121 |
acaaagattataaaatccttcatatttttctttaacacctacaataatattccacaataaatttagtggaaccgtcttgttctcaatgcttaaagatagc |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9112331 |
acaaagataataaaatccttcatatttttctttaacacctacaataatattccacaataaatttagtggaaccgtcttgttctcaatgcttaaagatagc |
9112232 |
T |
|
| Q |
221 |
aagcattgacaacacaatcaaagctcccatcatagccactgaatttgtaag |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9112231 |
aagcattgacaacacaatcaaagctcccatcatagccactggatttgtaag |
9112181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 9112417 - 9112333
Alignment:
| Q |
1 |
agaaagacgagttattaaattaattt-aaatacatgaaattgacatgacaatattattggatgacggtgtaaatatcctttacac |
84 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9112417 |
agaaagacgagttactaaattcatttcaaatacatgaaattgacatgacaatattattggatgacggtgtaaatatcctttacac |
9112333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 270
Target Start/End: Complemental strand, 8747092 - 8747029
Alignment:
| Q |
207 |
tgcttaaagatagcaagcattgacaacacaatcaaagctcccatcatagccactgaatttgtaa |
270 |
Q |
| |
|
||||| ||||| || ||||||||||||||||| || |||| |||||||||||||||||||||| |
|
|
| T |
8747092 |
tgcttgaagatggcgagcattgacaacacaattgaaactccaatcatagccactgaatttgtaa |
8747029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 270
Target Start/End: Complemental strand, 9101366 - 9101303
Alignment:
| Q |
207 |
tgcttaaagatagcaagcattgacaacacaatcaaagctcccatcatagccactgaatttgtaa |
270 |
Q |
| |
|
||||||||||| || ||||||||||| ||||| || |||| ||||||||||||||| |||||| |
|
|
| T |
9101366 |
tgcttaaagatggcgagcattgacaatacaattgaaactccgatcatagccactgaacttgtaa |
9101303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 263
Target Start/End: Complemental strand, 9019420 - 9019370
Alignment:
| Q |
213 |
aagatagcaagcattgacaacacaatcaaagctcccatcatagccactgaa |
263 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
9019420 |
aagatggcaagcattgacaacacaattgaagctccgatcatagcaactgaa |
9019370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University