View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-25 (Length: 39)
Name: NF4290-Insertion-25
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.0000000000005
Query Start/End: Original strand, 3 - 39
Target Start/End: Original strand, 2487603 - 2487639
Alignment:
| Q |
3 |
aataattcaaggccaaaccgtgactaaagatgatgga |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487603 |
aataattcaaggccaaaccgtgactaaagatgatgga |
2487639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University