View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-26 (Length: 97)
Name: NF4290-Insertion-26
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-26 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 7e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 7e-46
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 34017261 - 34017357
Alignment:
| Q |
1 |
gagtagtccgtctttgagatgttcaggaagagcagagagaccgaaatcggaaaccttgagattcccatcggcgtcgaggaggagattctgcggttta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34017261 |
gagtagtccgtctttgagatgttcaggaagagcagagagaccgaaatcggaaaccttgagattcccatcggcgtcgaggaggagattttgcggttta |
34017357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 8e-18
Query Start/End: Original strand, 35 - 96
Target Start/End: Original strand, 15171845 - 15171906
Alignment:
| Q |
35 |
gagagaccgaaatcggaaaccttgagattcccatcggcgtcgaggaggagattctgcggttt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| || || || ||||||||||||||||||||||| |
|
|
| T |
15171845 |
gagagaccgaaatcggaaaccttgagattaccttcagcatcgaggaggagattctgcggttt |
15171906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University