View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-29 (Length: 209)
Name: NF4290-Insertion-29
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-29 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 9814343 - 9814143
Alignment:
| Q |
9 |
ataatatgctctaaatgatgactacacaatatccatacatgcttcttcaacgtcgatggtggccacaaataataatactatggtatatgatatgatttca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
9814343 |
ataatatgctctaaatgatgactacacaatatccatgcatgcttcttcaacgtcgatggtggccacaaataataatactatggtacatgatataatttca |
9814244 |
T |
 |
| Q |
109 |
tgtacttctttgttttgttg---attaatattataataaggcattcgatgtaatagtttgtatgtgtgtgtagtaagtctttgtgtttttctattatgtt |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9814243 |
tgtacttctttgttttgttgattattaatattataataaggcattcgatgtaatagtttgtatgtgtgt---gtaagtctttgtgtttttctattatgtt |
9814147 |
T |
 |
| Q |
206 |
gttg |
209 |
Q |
| |
|
|||| |
|
|
| T |
9814146 |
gttg |
9814143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University