View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4290-Insertion-3 (Length: 84)

Name: NF4290-Insertion-3
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4290-Insertion-3
NF4290-Insertion-3
[»] chr5 (2 HSPs)
chr5 (9-84)||(16464795-16464870)
chr5 (35-84)||(16471740-16471789)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 5e-31; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 16464870 - 16464795
Alignment:
9 attcataaacccatcacagactcgcaagtttaacaaccatactcacttgtatgattattcaagttccgatgtgatg 84  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
16464870 attcataaacccatcatagactcgcaagtttaacaaccatactcacttgtatgattattcaagttccgatatgatg 16464795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 35 - 84
Target Start/End: Complemental strand, 16471789 - 16471740
Alignment:
35 agtttaacaaccatactcacttgtatgattattcaagttccgatgtgatg 84  Q
    ||||| |||||||||| |||||| ||||||||||||||||||||||||||    
16471789 agtttgacaaccatacacacttgaatgattattcaagttccgatgtgatg 16471740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University