View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-3 (Length: 84)
Name: NF4290-Insertion-3
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-3 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 5e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 16464870 - 16464795
Alignment:
| Q |
9 |
attcataaacccatcacagactcgcaagtttaacaaccatactcacttgtatgattattcaagttccgatgtgatg |
84 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16464870 |
attcataaacccatcatagactcgcaagtttaacaaccatactcacttgtatgattattcaagttccgatatgatg |
16464795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 35 - 84
Target Start/End: Complemental strand, 16471789 - 16471740
Alignment:
| Q |
35 |
agtttaacaaccatactcacttgtatgattattcaagttccgatgtgatg |
84 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
16471789 |
agtttgacaaccatacacacttgaatgattattcaagttccgatgtgatg |
16471740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University