View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-31 (Length: 243)
Name: NF4290-Insertion-31
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-31 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 243
Target Start/End: Original strand, 45685301 - 45685532
Alignment:
| Q |
7 |
aaatctgcaaccanatatcctccatatttttcaacccccactcatccatacccaccaccacggggttgacctcttactaaccgaactctccaccatctcc |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45685301 |
aaatctgcaaccaaatatcctccatatttt-caacccccactcatccatacccaccaccac----ttgacctcttactaaccgaactctccaccatctcc |
45685395 |
T |
|
| Q |
107 |
tctcaaaacggccgcgttttcctctacggtgttggccgcgaaggcctaatgctcaaagccttctgcatgcgcttagcccatctgggcctctcagcccacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45685396 |
tctcaaaacggccgcgttttcctctacggtgttggccgcgaaggcctaatgctcaaagccttctgcatgcgcttagcccatctgggcctctcagcccacc |
45685495 |
T |
|
| Q |
207 |
tagtcttcgacatgaccactcctccaatcaccaccaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45685496 |
tagtcttcgacatgaccactcctccaatcaccaccaa |
45685532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University