View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-32 (Length: 55)
Name: NF4290-Insertion-32
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-32 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 6 - 55
Target Start/End: Original strand, 14757424 - 14757473
Alignment:
| Q |
6 |
aacatgtctgtcactgatgttgcttggaggaatcttaacgatgtcgatat |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14757424 |
aacatgtctgtcactgatgttgcttggaggaatcttaacgatgtcgatat |
14757473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 3613601 - 3613646
Alignment:
| Q |
6 |
aacatgtctgtcactgatgttgcttggaggaatcttaacgatgtcg |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3613601 |
aacatgtctgtcactgatgttgcttggaggaatctcaacgatgtcg |
3613646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University