View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4290-Insertion-32 (Length: 55)

Name: NF4290-Insertion-32
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4290-Insertion-32
NF4290-Insertion-32
[»] chr3 (1 HSPs)
chr3 (6-55)||(14757424-14757473)
[»] chr1 (1 HSPs)
chr1 (6-51)||(3613601-3613646)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 6 - 55
Target Start/End: Original strand, 14757424 - 14757473
Alignment:
6 aacatgtctgtcactgatgttgcttggaggaatcttaacgatgtcgatat 55  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
14757424 aacatgtctgtcactgatgttgcttggaggaatcttaacgatgtcgatat 14757473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 3613601 - 3613646
Alignment:
6 aacatgtctgtcactgatgttgcttggaggaatcttaacgatgtcg 51  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||    
3613601 aacatgtctgtcactgatgttgcttggaggaatctcaacgatgtcg 3613646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University