View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-35 (Length: 80)
Name: NF4290-Insertion-35
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-35 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 8e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 6 - 80
Target Start/End: Original strand, 26949160 - 26949234
Alignment:
| Q |
6 |
tttctgagctgcattgagagttgaaatgtctgcggaaatagtaaatccttcatctacaatttcccataaatcttg |
80 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26949160 |
tttctaagctgcattgagagttgaaatgtctgcggaaatagtaaatccttcatctacaatttcccataaatcttg |
26949234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University