View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290-Insertion-37 (Length: 243)
Name: NF4290-Insertion-37
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290-Insertion-37 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0002 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 124 - 243
Target Start/End: Original strand, 401427 - 401547
Alignment:
| Q |
124 |
ttttttaagggattcgacagcattgtcacaccattcgaatttgtgtgcaggatggaatggatatttagt-tcacggcttccaatgcttattaccaccttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
401427 |
ttttttaagggattcgacagcattgtcacaccattcgagtttgtgtgcaggatggaatggatatttagtatcacggcctccaatgcttattaccaccttc |
401526 |
T |
|
| Q |
223 |
acattgcgatggttggtcttg |
243 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
401527 |
acattgccatggttggtcttg |
401547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University