View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290_high_8 (Length: 220)
Name: NF4290_high_8
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290_high_8 |
 |  |
|
| [»] scaffold0137 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 14 - 175
Target Start/End: Complemental strand, 3900491 - 3900330
Alignment:
| Q |
14 |
cttatcactatcaaccagctcatgaaacccaaattcatcatcatcaaccctctctcctcaccttcgacgtggaaccctcactgaaaccctttctcaccgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3900491 |
cttatcactatcaaccagctcatgaaacccaaattcatcatcatcaaccctctctcctcaccgtcgacgtggaaccctcactgaaaccctttctcaccgt |
3900392 |
T |
 |
| Q |
114 |
gaaacattcaacatcaaccctaaccctcaccaaaaacttccattcactacttttattaactt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3900391 |
gaaacattcaacatcaaccctaaccctcaccaaaaactttcattcactacttttattaactt |
3900330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0137 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 7629 - 7457
Alignment:
| Q |
14 |
cttatcactatcaaccagctcatgaaacccaaattcatcatcatcaaccctctctcctcaccttcgacgtggaaccctcactgaaaccctttctcaccgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7629 |
cttatcactatcaaccagctcatgaaatccaaattcatcatca---accctctctccttaccgtcgatgtggaaccctcactgaaaccctttctcaccgt |
7533 |
T |
 |
| Q |
114 |
gaaacattcaacatcaaccctaaccctcaccaaaaacttccattcactacttttattaacttatattaccacttgt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7532 |
gaaacattcaacatcaaccctaaccctcaccaaaaactttcattcactacttttattaacttatattaccacttgt |
7457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University