View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4290_low_13 (Length: 233)
Name: NF4290_low_13
Description: NF4290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4290_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 36229971 - 36229751
Alignment:
| Q |
3 |
taatcatatggaatccaaatccttaaactgcaatgttggtcatacccaagttacacaagcaaccaacatccatcctttagtgttatttgagttcacaaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36229971 |
taatcatatggaatccaaatccttaaactgcaatgttggtcatacccaagttactcaagcaaccaacatccatcctttagtgttatttgagttcacaaat |
36229872 |
T |
|
| Q |
103 |
ttacgaaatagcaaatttctccttcaaatttaatcacgtcaatctaaatcccctcagccaaatcactctcttagggttgctaattaaggtgtcaaataaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36229871 |
ttacgaaatagcaaatttctccttcaaatttaatcacgtcaatctaaattccctcagccaaatcactctcttagggttgctaattaaggtgtcaaatgaa |
36229772 |
T |
|
| Q |
203 |
accgtgacatgttcacgttga |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36229771 |
accgtgacatgttcacgttga |
36229751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 139
Target Start/End: Original strand, 38318546 - 38318589
Alignment:
| Q |
96 |
cacaaatttacgaaatagcaaatttctccttcaaatttaatcac |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
38318546 |
cacaaatttatgaaatagcaaatttctccttcaatttgaatcac |
38318589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University