View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-21 (Length: 140)
Name: NF4291-Insertion-21
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 5 - 140
Target Start/End: Complemental strand, 46706587 - 46706461
Alignment:
| Q |
5 |
agtttgtacttccgatgtttattatggttagatagaccttaaaactcggcgagtattaatagaagtacttacatatcatccaccaaagaagtccacatac |
104 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46706587 |
agtttgtacttccgatgcttattatggtcagatagaccttaaaactcggcgagta---------gtacttacatatcatccaccaaataagtccacatac |
46706497 |
T |
 |
| Q |
105 |
gagaaacagaagttgaacgtttgaccttgcgatgga |
140 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46706496 |
gagaaacagaagttgaacgtctgaccttgcgatgga |
46706461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University