View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-27 (Length: 181)
Name: NF4291-Insertion-27
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-27 |
 | |
|
| [»] chr8 (5 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 7e-91; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 28279282 - 28279462
Alignment:
| Q |
1 |
agattctagtttcaatgtcaagcttggtgattttgggttggctaaattaatagaccatgaacttgggcctcaaacaacagtgattgctggaaccatagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28279282 |
agattctagtttcaatgtcaagcttggtgattttgggttggctaaattaatagaccatgagcttgggcctcaaacaacagtgattgctggaaccttagga |
28279381 |
T |
|
| Q |
101 |
tatttggctccagaatatataagtacaggtaaggctagcaaagaatctgatgtctatagctttggcgttgtcgtcttggag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28279382 |
tatttggctccagaatatataagtacaggtaaggctagcaaagaatctgatgtctatagctttggggttgtcgtcttggag |
28279462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 28289147 - 28289327
Alignment:
| Q |
1 |
agattctagtttcaatgtcaagcttggtgattttgggttggctaaattaatagaccatgaacttgggcctcaaacaacagtgattgctggaaccatagga |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||| |||| || ||||| |||| || |||||||||||| |||| |||||| |||| |
|
|
| T |
28289147 |
agattctagtttcaatgttaagcttggtgactttgggttggctaaactaatggatcatgagattggaccccaaacaacagtggttgccggaaccttaggc |
28289246 |
T |
|
| Q |
101 |
tatttggctccagaatatataagtacaggtaaggctagcaaagaatctgatgtctatagctttggcgttgtcgtcttggag |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||| ||||| ||||| | ||||||| |
|
|
| T |
28289247 |
tatttggctccagaatatataagtacaggtaaggctagcaaagagtcagatgtgtatagttttggggttgttgccttggag |
28289327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 28264589 - 28264410
Alignment:
| Q |
1 |
agattctagtttcaatgtcaagcttggtgattttgggttggctaaattaatagaccatgaacttgggcctcaaacaacagtgattgctggaaccatagga |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||| |||| || |||||||||||| |||| |||||| |||| |
|
|
| T |
28264589 |
agattctagtttcaatgttaagcttggtgactttgggttggctaagctaatggaccatgagattggaccccaaacaacagtggttgccggaaccttaggc |
28264490 |
T |
|
| Q |
101 |
tatttggctccagaatatataagtacaggtaaggctagcaaagaatctgatgtctatagctttggcgttgtcgtcttgga |
180 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||| |||||||||| || ||||| ||||| ||||| ||||| | |||||| |
|
|
| T |
28264489 |
tatatggctccggaatatataagtacaggtaagactagcaaagagtcagatgtgtatagttttggggttgttgccttgga |
28264410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 28304606 - 28304442
Alignment:
| Q |
1 |
agattctagtttcaatgtcaagcttggtgattttgggttggctaaattaatagaccatgaacttgggcctcaaacaacagtgattgctggaaccatagga |
100 |
Q |
| |
|
|||||| ||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || | | | || ||||| | || |
|
|
| T |
28304606 |
agattcaagttttaatgttaagcttggtgattttgggttggctaaattaatggaccatgaacttgggcctcaaacgacggggctggccggaacattcggc |
28304507 |
T |
|
| Q |
101 |
tatttggctccagaatatataagtacaggtaaggctagcaaagaatctgatgtctatagctttgg |
165 |
Q |
| |
|
||| | |||||||||||| | |||||||| | ||| || ||||| || ||||| ||||| ||||| |
|
|
| T |
28304506 |
tatctagctccagaatatgtgagtacaggaagggcgagtaaagagtcagatgtttatagttttgg |
28304442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 28294397 - 28294327
Alignment:
| Q |
8 |
agtttcaatgtcaagcttggtgattttgggttggctaaattaatagaccatgaacttgggcctcaaacaac |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
28294397 |
agtttcaatgtcaagcttggtgattttgggttggctaagttaatggaccatgaacttgggccgcaaacaac |
28294327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 7 - 44
Target Start/End: Original strand, 47871662 - 47871699
Alignment:
| Q |
7 |
tagtttcaatgtcaagcttggtgattttgggttggcta |
44 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47871662 |
tagtttcaatgcaaagcttggtgattttgggttggcta |
47871699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University