View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-28 (Length: 63)
Name: NF4291-Insertion-28
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 33
Target Start/End: Complemental strand, 36286007 - 36285979
Alignment:
| Q |
5 |
agaactaaccgaagagataagaatacaag |
33 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36286007 |
agaactaaccgaagagataagaatacaag |
36285979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University