View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4291-Insertion-39 (Length: 116)

Name: NF4291-Insertion-39
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4291-Insertion-39
NF4291-Insertion-39
[»] chr6 (1 HSPs)
chr6 (36-116)||(10603829-10603909)
[»] chr2 (1 HSPs)
chr2 (53-114)||(20982186-20982247)


Alignment Details
Target: chr6 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 10603909 - 10603829
Alignment:
36 ttatgtaactcagaaagctgtaccagtctctttcaatgtatccggcgacctggattcagaatcctatggtaaaattgtgaa 116  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
10603909 ttatgtaactcagaaagctgtaccagtctctatcaatgtatccggcgacctggattcagaatcctatggtaaaattgtgaa 10603829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 53 - 114
Target Start/End: Complemental strand, 20982247 - 20982186
Alignment:
53 ctgtaccagtctctttcaatgtatccggcgacctggattcagaatcctatggtaaaattgtg 114  Q
    ||||| ||||||||||||||||||||  |||| |||||||||||||||||||||||||||||    
20982247 ctgtatcagtctctttcaatgtatccaacgacgtggattcagaatcctatggtaaaattgtg 20982186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University