View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-39 (Length: 116)
Name: NF4291-Insertion-39
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-39 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 10603909 - 10603829
Alignment:
| Q |
36 |
ttatgtaactcagaaagctgtaccagtctctttcaatgtatccggcgacctggattcagaatcctatggtaaaattgtgaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10603909 |
ttatgtaactcagaaagctgtaccagtctctatcaatgtatccggcgacctggattcagaatcctatggtaaaattgtgaa |
10603829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 53 - 114
Target Start/End: Complemental strand, 20982247 - 20982186
Alignment:
| Q |
53 |
ctgtaccagtctctttcaatgtatccggcgacctggattcagaatcctatggtaaaattgtg |
114 |
Q |
| |
|
||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
20982247 |
ctgtatcagtctctttcaatgtatccaacgacgtggattcagaatcctatggtaaaattgtg |
20982186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University