View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-4 (Length: 46)
Name: NF4291-Insertion-4
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-4 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 21205053 - 21205015
Alignment:
| Q |
8 |
tgaagattttttacactgtctatcaatcataatcattag |
46 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21205053 |
tgaagagtttttacactgtctatcaatcataatcattag |
21205015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 28; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 10 - 41
Target Start/End: Complemental strand, 7601473 - 7601442
Alignment:
| Q |
10 |
aagattttttacactgtctatcaatcataatc |
41 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
7601473 |
aagattttttacactgtcaatcaatcataatc |
7601442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 27; Significance: 0.0000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 27; E-Value: 0.0000007
Query Start/End: Original strand, 10 - 40
Target Start/End: Complemental strand, 5661919 - 5661889
Alignment:
| Q |
10 |
aagattttttacactgtctatcaatcataat |
40 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
5661919 |
aagattttttacactgtcaatcaatcataat |
5661889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University