View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-41 (Length: 190)
Name: NF4291-Insertion-41
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-41 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 67 - 190
Target Start/End: Original strand, 24205466 - 24205590
Alignment:
| Q |
67 |
atattctattggtagtcagagcttgagttcttgacctctttctcaaactctttcgagtgtctt-aactcaaccacttgagctacgcctcagcgagaaagt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24205466 |
atattctattggtagtcagagcttgagttcttgatctctttctcaaactctttcgagtgtcttaaactcaaccacttgagctacgcctcagcgagaaagt |
24205565 |
T |
|
| Q |
166 |
aatggttcaagagtgcagtagcctt |
190 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24205566 |
gatggttcaagagtgcagtagcctt |
24205590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 36658056 - 36658011
Alignment:
| Q |
14 |
gaacagcatttggacagagcgatgttcgctttg-taaaatatgaga |
58 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
36658056 |
gaacagcatttggacagagtgatgttcgctttgttaaaatatgaga |
36658011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.000001
Query Start/End: Original strand, 106 - 149
Target Start/End: Original strand, 35655048 - 35655091
Alignment:
| Q |
106 |
ttctcaaactctttcgagtgtcttaactcaaccacttgagctac |
149 |
Q |
| |
|
||||||||||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
35655048 |
ttctcaaactccttcgagtgtcccaactcaactacttgagctac |
35655091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 29403291 - 29403248
Alignment:
| Q |
14 |
gaacagcatttggacagagcgatgttcgctttg-taaaatatga |
56 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29403291 |
gaacagcatttggacagagcgatgttcgttttgttaaaatatga |
29403248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University