View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-46 (Length: 312)
Name: NF4291-Insertion-46
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 35837492 - 35837758
Alignment:
| Q |
1 |
agaaaaagcctgcaaaatacagaaagtgacaataatttgattgaagtatacttatgaagaaatgataaacacaaaatcaaatcaactgttcttactcagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35837492 |
agaaaaagcctgcaaaatacagaaagtgacaataatttgattgaagtatacttatgaagaaatgataaacacaaa-tcaaatcaactgttcttactcagc |
35837590 |
T |
|
| Q |
101 |
acactcggtgagcttgccagtgttctggctttcaacaatcttgagaatcaaggacttgttctcatcaagatactgcatc-nnnnnnnnnccggggggttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35837591 |
acactcggtgagcttgccagtgttctggctttcaacaatcttgagaatcaaggacttgttctcatcaagatactgcatcaaaaaaaaaaaaaaagggttt |
35837690 |
T |
|
| Q |
200 |
tcactgaactgtctgaaactgaaagagtctgagaagagcacatgcagttcagagtatccaatggaatt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35837691 |
tcactgaactgtctgaaactgaaagagtctgagaagagcacatgcagttcagagtatccaatggaatt |
35837758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 91 - 166
Target Start/End: Complemental strand, 47687197 - 47687122
Alignment:
| Q |
91 |
cttactcagcacactcggtgagcttgccagtgttctggctttcaacaatcttgagaatcaaggacttgttctcatc |
166 |
Q |
| |
|
||||||| ||||||||| | |||||||| | ||||| || || |||||||| |||||||| |||||||||||||| |
|
|
| T |
47687197 |
cttactcggcacactcgctaagcttgcccgaattctgactctctacaatcttcagaatcaaagacttgttctcatc |
47687122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University