View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-49 (Length: 75)
Name: NF4291-Insertion-49
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-49 |
 |  |
|
| [»] scaffold0190 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0190 (Bit Score: 75; Significance: 3e-35; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 75; E-Value: 3e-35
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 4401 - 4327
Alignment:
| Q |
1 |
gtatgcaggtgtagaagatggtagcatggaccttgaagtatgtcttccttgtgaaattttggaggcaattagaaa |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4401 |
gtatgcaggtgtagaagatggtagcatggaccttgaagtatgtcttccttgtgaaattttggaggcaattagaaa |
4327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University