View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-50 (Length: 165)
Name: NF4291-Insertion-50
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 5e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 5e-45
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 5835101 - 5835253
Alignment:
| Q |
1 |
tgttgggtgttttggaattgaaacaaagaaatatttatttaagagaatagtttaattacgtacgtataacttataaggatatgaagaagaatcattgaag |
100 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5835101 |
tgttgggtgttt-ggaattgaaacaatgaaatatttattca-gagaatagtttaatcacgtacgtataacttataaggatatgaagaagaatcattgaag |
5835198 |
T |
 |
| Q |
101 |
aagaatgnnnnnnnaatttanaaaaatgtgctacgtatagttaaggaatagttactata |
159 |
Q |
| |
|
||||||| |||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5835199 |
aagaatgttttt----tttaaaaaaaagtgctacgtatagttaaggaatagttactata |
5835253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University