View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-52 (Length: 157)
Name: NF4291-Insertion-52
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-52 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 1e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 6 - 157
Target Start/End: Original strand, 29612929 - 29613080
Alignment:
| Q |
6 |
gtaatgtaggtcaaccagatgttgatgttggcaacgaaattagtcaggttattattgagtcatatccagattgccaaaaagatgtatctagtgaaggtca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29612929 |
gtaatgtaggtcaaccagatgttgatgttggcaacgaaattagtcaagttattattgagtcatatccagattgccaaaaagaggtatctagtgaaggtca |
29613028 |
T |
|
| Q |
106 |
agatattcactgttcttcagattccataacagaggttgctagtggtggaggt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29613029 |
agatattcactgttcttcagattccataacagaggttgctagtgatggaggt |
29613080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 53 - 112
Target Start/End: Original strand, 29525178 - 29525237
Alignment:
| Q |
53 |
gttattattgagtcatatccagattgccaaaaagatgtatctagtgaaggtcaagatatt |
112 |
Q |
| |
|
||||||||||| ||||||| |||| |||| |||| ||||||||||||||||||| |||| |
|
|
| T |
29525178 |
gttattattgattcatatctagataaccaacaagaggtatctagtgaaggtcaagttatt |
29525237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University