View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-55 (Length: 101)
Name: NF4291-Insertion-55
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-55 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 3e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 3e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 16806027 - 16806127
Alignment:
| Q |
1 |
acattttcgtcaatatcatcactaacaagtgtcaatattgagggtcgctttattcgaatggaatacataagaatctcactgaattttcaaaagtgttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16806027 |
acattttcgtcaatatcatcactaacaagtgtcaatattgagggtcactttattcgaatggaatacataagaatctcactgaattttcaaaagtgttctc |
16806126 |
T |
 |
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
16806127 |
g |
16806127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University