View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4291-Insertion-6 (Length: 84)
Name: NF4291-Insertion-6
Description: NF4291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4291-Insertion-6 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 40775868 - 40775944
Alignment:
| Q |
7 |
acatattgatacgataattcaaatctccaaaccagaaaatactgactgttagcagaaagcaatccgtcaatgaattca |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40775868 |
acatattgatacgataattcaaatctccaaaccagaaaat-ctgactgttagcagaaagcaatccgtcaatgaattca |
40775944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 43
Target Start/End: Original strand, 40768976 - 40769012
Alignment:
| Q |
7 |
acatattgatacgataattcaaatctccaaaccagaa |
43 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||| |
|
|
| T |
40768976 |
acatattgatacgataattcaaatccccgaaccagaa |
40769012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 4679102 - 4679053
Alignment:
| Q |
7 |
acatattgatacgataattcaaatctccaaaccagaaaatactgactgtta |
57 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
4679102 |
acatactgattcgataattcaaatctccgaaccagaaaat-ctgactgtta |
4679053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University